View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4809_low_9 (Length: 237)
Name: NF4809_low_9
Description: NF4809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4809_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 52 - 222
Target Start/End: Complemental strand, 34647303 - 34647133
Alignment:
| Q |
52 |
tcaatggcaaatattttacatgtgagtgacaatgtacatgcagcaaatgaagtatgtgatagatttgcgggcgctggatttcacagtaacttgataagtt |
151 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34647303 |
tcaatgacaaatattttacatgtgagtgacaatgtacatgcagcaaatgaagtatgtgatagatttgcgggcgctggatttcacagtaacttgataagtt |
34647204 |
T |
|
| Q |
152 |
acctaacccaagagttgaatatgccattggtagctgcttcaaatacactcacaaactttggtggaacatct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34647203 |
acctaacccaagagttgaatatgccattggtagctgcttcaaatacactcacaaactttggtggaacatct |
34647133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 89 - 219
Target Start/End: Complemental strand, 34661431 - 34661301
Alignment:
| Q |
89 |
atgcagcaaatgaagtatgtgatagatttgcgggcgctggatttcacagtaacttgataagttacctaacccaagagttgaatatgccattggtagctgc |
188 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||| |||| ||| | |||||||||||||||||||||| |||||||||||||||||||||||| | || |
|
|
| T |
34661431 |
atgcagctaatgaggtatgtgatagatttgcggtgactggttttaatggtaacttgataagttacctaactcaagagttgaatatgccattggtatcagc |
34661332 |
T |
|
| Q |
189 |
ttcaaatacactcacaaactttggtggaaca |
219 |
Q |
| |
|
| |||| |||||||||| ||||||||||||| |
|
|
| T |
34661331 |
tgcaaacacactcacaatctttggtggaaca |
34661301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 89 - 182
Target Start/End: Complemental strand, 34667584 - 34667491
Alignment:
| Q |
89 |
atgcagcaaatgaagtatgtgatagatttgcgggcgctggatttcacagtaacttgataagttacctaacccaagagttgaatatgccattggt |
182 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| ||| |||||| ||||| || ||| | ||||||||||||||||| |
|
|
| T |
34667584 |
atgcagcaaatgaagtgtgtgatagatttgcgagcgctggatttcatgcaaacatgataacctaccttacacaacaattgaatatgccattggt |
34667491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University