View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4810-Insertion-8 (Length: 316)
Name: NF4810-Insertion-8
Description: NF4810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4810-Insertion-8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 8 - 241
Target Start/End: Complemental strand, 42115823 - 42115591
Alignment:
| Q |
8 |
gatcaaggcttattccttgagatgatcggtggttaactcatgaactacaacggttgggagttaggatctgatgctgttaaacaactagagcattttagaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42115823 |
gatcaaggcttattccttgagatgatcggtggttaactcattaactacaacggttgggagttaggatctgatgctgttaaacaactagagcattttataa |
42115724 |
T |
 |
| Q |
108 |
aacttgaggggcctgtgagcattttaatttgaggggtctgtagagcaaaatctcnnnnnnnnnnnnnnnnnnatctcaaatcttaaatgatttgggcctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42115723 |
aacttgaggggcctgtgagcattttaatttgaggggtctgtagagcaaaatctc-ttgtgtattgttgttgtatctcaaatcttaaatgatttgggcctt |
42115625 |
T |
 |
| Q |
208 |
ttctctctttaactgatcttcttgtttttattcc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42115624 |
ttctctctttaactgatcttcttgtttttattcc |
42115591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 294
Target Start/End: Complemental strand, 42115572 - 42115535
Alignment:
| Q |
258 |
tccctaacaacaagctcttttacaaatg-cttcacata |
294 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42115572 |
tccctaacaacaagctcttttacaaatgccttcacata |
42115535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University