View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4811-Insertion-10 (Length: 90)
Name: NF4811-Insertion-10
Description: NF4811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4811-Insertion-10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 8e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 8e-24
Query Start/End: Original strand, 19 - 74
Target Start/End: Complemental strand, 21516471 - 21516416
Alignment:
| Q |
19 |
tttgtcctttataattctgcaatttatcattcagttatttattttcatgcaatatt |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21516471 |
tttgtcctttataattctgcaatttatcattcagttatttattttcatgcaatatt |
21516416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 69
Target Start/End: Original strand, 20685060 - 20685104
Alignment:
| Q |
25 |
ctttataattctgcaatttatcattcagttatttattttcatgca |
69 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
20685060 |
ctttataattctgcaatttatcattcagccatttacttttatgca |
20685104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University