View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4812-Insertion-11 (Length: 236)
Name: NF4812-Insertion-11
Description: NF4812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4812-Insertion-11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 34 - 236
Target Start/End: Complemental strand, 52716135 - 52715927
Alignment:
| Q |
34 |
gaaattgttatagctagggtgacnnnnnnnnnngagagtttgtgtataaattt-atttaagaaggaaacatggctgagaa---aggtttgattctgtatt |
129 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
52716135 |
gaaattgttatagctagggtgacaaaaaaaagagagagtttgtgtataaattttatttaagaaggaaacatggctgagaagaaaggtttaattctgtatt |
52716036 |
T |
 |
| Q |
130 |
gttaagtcttctcttatagagggtgacacct--atgtttataattaaatgagatttataaagtttataataaaaaatggaagttcaaatgtagacagaag |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52716035 |
gttaagtcttctcttatagagggtgacacctctatgtttataattaaatgagatttataaagtttataataaaaaatggaagttcaaatgtagacagaag |
52715936 |
T |
 |
| Q |
228 |
agggttgga |
236 |
Q |
| |
|
||||||||| |
|
|
| T |
52715935 |
agggttgga |
52715927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University