View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4812-Insertion-17 (Length: 200)
Name: NF4812-Insertion-17
Description: NF4812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4812-Insertion-17 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 40 - 200
Target Start/End: Original strand, 45304018 - 45304178
Alignment:
| Q |
40 |
atttcatttcatagaaagaggaataatggaatgggggagtgcccaaaagctactgacttgacttgaatgaatatgcacaagccccaaaagcccagctaag |
139 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45304018 |
atttcatttcatagaaagaagaataatggaatgggggagtgcccaaaagctactgacttgacttgaatgaatatgcacaagccccaaaagcccagctaag |
45304117 |
T |
|
| Q |
140 |
tttcataacagcagccccgacagaaaggaagtaatgcagcttttaggacccttttcatttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45304118 |
tttcataacagcagccccgacagaaaggaaggaatgcagcttttaggacccttttcatttc |
45304178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University