View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4812_high_1 (Length: 603)
Name: NF4812_high_1
Description: NF4812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4812_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 560; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 560; E-Value: 0
Query Start/End: Original strand, 13 - 584
Target Start/End: Original strand, 28022080 - 28022651
Alignment:
| Q |
13 |
gattattctatagtttgatttttgtttggcttaaccttttgtttttggaacataaggatcaaatcaagcggcatcatccattggatttgaataccttgaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022080 |
gattattctatagtttgatttttgtttggcctaaccttttgtttttggaacataaggatcaaatcaagcggcatcatccattggatttgaataccttgaa |
28022179 |
T |
 |
| Q |
113 |
aggccatggtgatgcagttacaggaatatgtttctctcctgatggacgaaacttggcaacaggtatttaaacatatttgttcataaataatatctgcagt |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022180 |
aggccatggtgatgcagttacagggatatgtttctctcctgatggacgaaacttggcaacaggtatttaaacatatttgttcataaataatatctgcagt |
28022279 |
T |
 |
| Q |
213 |
tatgtttatagatactaccatcatgatttcatcaaccgaagatatatctagtaatgtttatagttactaccgtcttgattgcatcaacctttttgtaaat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022280 |
tatgtttatagatactaccatcatgatttcatcaaccgaagatatatctagtaatgtttatagttactaccgtcttgattgcatcaacctttttgtaaat |
28022379 |
T |
 |
| Q |
313 |
gatcacatatggctctccctaagtttacttcactgtgagggttagagttgtgttggtgcttcatagccaataggcttgcaagaattatttgctaacacaa |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022380 |
gatcacatatggctctccctaagtttacttcactgtgagggttagagttgtgttggtgcttcatagccaataggcttgcaagaattatttgctaacacaa |
28022479 |
T |
 |
| Q |
413 |
acctcttccctttaatctggccctcttacagtctctctcatgatcccccttgccattagtttcttcgtttgtgttgcagagaataaagattctctccttc |
512 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28022480 |
acctcttccctttaatctggccctcttacagtctctctcatgatcccccttgccattagtttcttcgtttgtgttgcagagaataaagagtctctccttc |
28022579 |
T |
 |
| Q |
513 |
cctcgcccactttgattaattttattgcaaagtggacatgttctatttttgagtttagcagcataagctctc |
584 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022580 |
cctcgcccactttgattaattttattgcaaagtggacatgttctatttttgagtttagcagcataagctctc |
28022651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University