View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4812_high_11 (Length: 234)
Name: NF4812_high_11
Description: NF4812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4812_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 41661681 - 41661576
Alignment:
| Q |
1 |
cacgcttcattgacaatgaatataactatctaaaaagaactactagctttagttt-----agttcaaaatcttaacggcgaataatattgtgtgaaaagt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41661681 |
cacgcttcattgacaatgaatataactatctaaaaagaactactagctttagtttagtttagttcaaaatcttaacggtgaataatattgtgtgaaaagt |
41661582 |
T |
 |
| Q |
96 |
tcaatt |
101 |
Q |
| |
|
|||||| |
|
|
| T |
41661581 |
tcaatt |
41661576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University