View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4812_high_11 (Length: 234)

Name: NF4812_high_11
Description: NF4812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4812_high_11
NF4812_high_11
[»] chr7 (1 HSPs)
chr7 (1-101)||(41661576-41661681)


Alignment Details
Target: chr7 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 41661681 - 41661576
Alignment:
1 cacgcttcattgacaatgaatataactatctaaaaagaactactagctttagttt-----agttcaaaatcttaacggcgaataatattgtgtgaaaagt 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||| |||||||||||||||||||||    
41661681 cacgcttcattgacaatgaatataactatctaaaaagaactactagctttagtttagtttagttcaaaatcttaacggtgaataatattgtgtgaaaagt 41661582  T
96 tcaatt 101  Q
    ||||||    
41661581 tcaatt 41661576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University