View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4812_high_7 (Length: 300)
Name: NF4812_high_7
Description: NF4812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4812_high_7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 6500195 - 6500492
Alignment:
| Q |
1 |
aatacagatagagatttagagagagaaaatcccaacaacaccttactttctctctctacaaccaaccacccttccttccatttcatcggaacctctcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6500195 |
aatacagatagagatttagagagagaaaatcccaacaacaccttactttctctctctacaaccaaccacccttccttccatttcatcggaacctctcatt |
6500294 |
T |
 |
| Q |
101 |
ctagatagattactcttcaatggaccactttcctcgctccactcaacctgatccgtcttctcaatggaccggaccggattctcaaaccggtttagaaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6500295 |
ctagatagattactcttcaatggaccactttcctcgctccactcaacctgatccgtcttctcaatggaccggaccggattctcaaaccggtttagaaggt |
6500394 |
T |
 |
| Q |
201 |
aaacaaactattttcttgtttannnnnnnngtagaatgtgaatgaattttgatctttgttgtaaaatgcagaacctatgtggcaattggggttaggtagt |
300 |
Q |
| |
|
||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6500395 |
aaataaactattttcttgttta--ttttttgtagaatgtgaatgaattttgatctttgttgtaaaatgcagaacctatgtggcaattggggttaggtagt |
6500492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University