View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4812_high_8 (Length: 259)
Name: NF4812_high_8
Description: NF4812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4812_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 10 - 202
Target Start/End: Original strand, 2127162 - 2127354
Alignment:
| Q |
10 |
attattctaaaaatgtcctcaaattctaaatcaatnnnnnnnntattaaaattattaagtcaaacaaggttatgagagtttgagccccaacttctctatt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
2127162 |
attattctaaaaatgtcctcaaattctaaatcaataaaaaaaatgttaaaattattaagtcaaacaagtttatgagagtttgagccccaacttttctatt |
2127261 |
T |
|
| Q |
110 |
tgattatgtggattttcaataactattannnnnnnnggaataactactacttataattttagggtgttgctaaccggtaccctcaaggcaatg |
202 |
Q |
| |
|
||||| ||||||||||||||||||| | ||||||| ||| |||||||||||| |||||||||||||||| |||||| ||||||| |
|
|
| T |
2127262 |
tgattgtgtggattttcaataactacttttttttttggaataatcactccttataattttaaggtgttgctaaccggtgccctcagggcaatg |
2127354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University