View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4812_low_11 (Length: 238)
Name: NF4812_low_11
Description: NF4812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4812_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 22 - 91
Target Start/End: Original strand, 19689229 - 19689298
Alignment:
| Q |
22 |
attaataaagattcggattttgaatgggcacgacaatgaaaataacaagaattggaatcgactgaattgg |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19689229 |
attaataaagattcggattttgaatgggcacgacaatgaaaataacaagaattggaatcgactgaattgg |
19689298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 220
Target Start/End: Original strand, 19689364 - 19689427
Alignment:
| Q |
157 |
cagtttctgaatcgtnnnnnnnccatacattagcaagcgatttcaaaagaaaataataaaataa |
220 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19689364 |
cagtttctgaatcgtaaaaaaaccatacattagcaagcgatttcaaaagaaaataataaaataa |
19689427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University