View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4812_low_11 (Length: 238)

Name: NF4812_low_11
Description: NF4812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4812_low_11
NF4812_low_11
[»] chr7 (2 HSPs)
chr7 (22-91)||(19689229-19689298)
chr7 (157-220)||(19689364-19689427)


Alignment Details
Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 22 - 91
Target Start/End: Original strand, 19689229 - 19689298
Alignment:
22 attaataaagattcggattttgaatgggcacgacaatgaaaataacaagaattggaatcgactgaattgg 91  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19689229 attaataaagattcggattttgaatgggcacgacaatgaaaataacaagaattggaatcgactgaattgg 19689298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 220
Target Start/End: Original strand, 19689364 - 19689427
Alignment:
157 cagtttctgaatcgtnnnnnnnccatacattagcaagcgatttcaaaagaaaataataaaataa 220  Q
    |||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||    
19689364 cagtttctgaatcgtaaaaaaaccatacattagcaagcgatttcaaaagaaaataataaaataa 19689427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University