View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4812_low_7 (Length: 325)
Name: NF4812_low_7
Description: NF4812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4812_low_7 |
 |  |
|
| [»] scaffold0426 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 107 - 316
Target Start/End: Complemental strand, 2127808 - 2127599
Alignment:
| Q |
107 |
tgtaaaatgtggtgaaaatgaagaacatgtacctgatttgattgaaatggcggaacgaagtagagtttgagaaggtttaacctaagtaagatggtggaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2127808 |
tgtaaaatgtggtgaaaatgaagaacatgtacctgatttgattgaaatggcggaacgaagtagagtttgagaaggtttaacctaagtaagatggtggaat |
2127709 |
T |
 |
| Q |
207 |
cgaatcaaattcgaatctagaaaagcaaaaggtgacatgtgaggtcggggtttgtctttgcatcacgttttagagccaccattacnnnnnnnattattta |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2127708 |
cgaatcaaattcgaatctagaaaagcaaaaggtgacatgtgaggtcggggtttgtctttgcatcacgttttagagccaccattactttttttattattta |
2127609 |
T |
 |
| Q |
307 |
tactttcttc |
316 |
Q |
| |
|
|||||||||| |
|
|
| T |
2127608 |
tactttcttc |
2127599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0426 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0426
Description:
Target: scaffold0426; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 111 - 149
Target Start/End: Complemental strand, 3721 - 3683
Alignment:
| Q |
111 |
aaatgtggtgaaaatgaagaacatgtacctgatttgatt |
149 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
3721 |
aaatgtggcgaaaatgaagaacatgtacttgatttgatt |
3683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University