View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4813-Insertion-18 (Length: 342)
Name: NF4813-Insertion-18
Description: NF4813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4813-Insertion-18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 8 - 193
Target Start/End: Original strand, 38346321 - 38346510
Alignment:
| Q |
8 |
attctgatccttaccaatacaatggtgttttagcaccacatgcaccatctgcttcagaacaaatgcaacatcaacaaatccaacactactatgatgatga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38346321 |
attctgatccttaccaatacaatggtgttttagcaccacatgcaccatctgcttcagaacaaatgcaacatcaacaaatccaacactactatgatgatga |
38346420 |
T |
|
| Q |
108 |
tgccaataacaactgtgttattatgtgatcattttgttggtatacattttacactac----tatggtttattgaaatttttgctttctgc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38346421 |
tgccaataacaactgtgttattatgtgatcagtttgttggtatacattttacactactatatatggtttattgaaatttttgctttctgc |
38346510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 261 - 342
Target Start/End: Original strand, 38346578 - 38346659
Alignment:
| Q |
261 |
cttttagggatatttaactagagatcccttannnnnnnnggattaggggannnnnnnnaagtttggatgctggactgctata |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38346578 |
cttttagggatatttaactagagatcccttattttttttggattaggggattttttttaagtttggatgctggactgctata |
38346659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 102
Target Start/End: Complemental strand, 45043453 - 45043361
Alignment:
| Q |
10 |
tctgatccttaccaatacaatggtgttttagcaccacatgcaccatctgcttcagaacaaatgcaacatcaacaaatccaacactactatgat |
102 |
Q |
| |
|
||||| ||||||| || ||||||| ||||||||| | | |||||||||| ||||||||| |||||||||||||| ||||||||||| ||||| |
|
|
| T |
45043453 |
tctgacccttacccatccaatggtattttagcactgcctccaccatctgcatcagaacaattgcaacatcaacaactccaacactacaatgat |
45043361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University