View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4813-Insertion-20 (Length: 302)
Name: NF4813-Insertion-20
Description: NF4813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4813-Insertion-20 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 176 - 302
Target Start/End: Original strand, 6800927 - 6801053
Alignment:
| Q |
176 |
acgttgtagtcgatactgaaggaaccgggtttttctacggcgaggactagaccggttaagcttgggccgttgataaaagtagcgtcggttattgatgctc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6800927 |
acgttgtagtcgatactgaaggaaccgggtttttctacggcgaggactagaccggttaagcttgggccgttgatgaaagtagcgtcggttattgatgctc |
6801026 |
T |
|
| Q |
276 |
ggagtttgacatcaccggcgttgaagg |
302 |
Q |
| |
|
|||||||||| |||||||||||||||| |
|
|
| T |
6801027 |
ggagtttgacgtcaccggcgttgaagg |
6801053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 8 - 132
Target Start/End: Original strand, 6800755 - 6800890
Alignment:
| Q |
8 |
gtatgtaggttaaattcaacggtttatcagcaaccctaacagtgttcataaattgaaacctaaaatcctgc-----------acaaaaaataaataaata |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6800755 |
gtatgtaggttaaattcaacggtttatcagcaaccctaacagtgttcataaattgaaacctaaaatcctgcacaaaaattaaacaaaaaataaataaata |
6800854 |
T |
|
| Q |
97 |
aaccgaaccggtttggtttagaaaatggattgaacg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6800855 |
aaccgaaccggtttggtttagaaaatggattgaacg |
6800890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University