View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4813-Insertion-21 (Length: 302)
Name: NF4813-Insertion-21
Description: NF4813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4813-Insertion-21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 7 - 255
Target Start/End: Complemental strand, 44355984 - 44355736
Alignment:
| Q |
7 |
atcatgttcctcggtctttccttaaagatagtgaaaacagtttggtattgctggatgaaggtggtgggaaccctcttgatatctccttgaacactgtttc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44355984 |
atcatgttcctcggtctttccttaaagatagtgaaaacagtttggtattgctggatgaaggtggtgggaaccctcttgatatctccttgaacactgtttc |
44355885 |
T |
|
| Q |
107 |
agtcacagatttacaagataacttttctaaattgccattccctacctatacttagtattatggacagaatataaaacacacataggtaaatcatattata |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44355884 |
agtcacagatttacaagataacttttctaaattgccattccctacctatacttaatattatggacagaatataaaacacacataggtaaatcatattata |
44355785 |
T |
|
| Q |
207 |
tacataatatgtttccttagcattttagtttggcttctatacatgaaaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44355784 |
tacataatatgtttccttagcattttagtttggcttctatacatgaaaa |
44355736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University