View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4813-Insertion-23 (Length: 270)
Name: NF4813-Insertion-23
Description: NF4813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4813-Insertion-23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 102 - 239
Target Start/End: Original strand, 13917963 - 13918100
Alignment:
| Q |
102 |
atatatatatgatcccatctattgtgttattattcactcgagattgatctacctttaaaatatatacataatactagattggtctaccaatgctcctcaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13917963 |
atatatatatgatcccatctattgtgttattattcactcgagattggtctacctttaaaatatatacataatactagattggtctaccaatgctcctcaa |
13918062 |
T |
|
| Q |
202 |
taacgtggcttatttgttctaaattcacgaattgattt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13918063 |
taacgtggcttatttgttctaaattcacgaatttattt |
13918100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 14 - 111
Target Start/End: Original strand, 13917813 - 13917910
Alignment:
| Q |
14 |
tcttgagggaatatacttttaagattttatgttataatgtgttgtaatgagttagtatttctatacactcgttaatatattttgcttaatatatatat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13917813 |
tcttgagggaatatacttttaagattttatgttataatgtgttgtaatgagttagtatttctatactctcgttaatatattttgcttaatatatatat |
13917910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University