View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4813-Insertion-27 (Length: 103)
Name: NF4813-Insertion-27
Description: NF4813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4813-Insertion-27 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 1e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 8 - 103
Target Start/End: Original strand, 13407955 - 13408050
Alignment:
| Q |
8 |
attctaagtttgaatattattttgagtaggtattgactttcacaatttggaaagtgtcatttatttatatgattaatttcaagtagttttaattga |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13407955 |
attctaagtttgaatattattttgagtaggtattgactttcacaatttggaaagtgtcatttatttatatgattaatttcaagtagttttaattga |
13408050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 8 - 71
Target Start/End: Complemental strand, 19173837 - 19173774
Alignment:
| Q |
8 |
attctaagtttgaatattattttgagtaggtattgactttcacaatttggaaagtgtcatttat |
71 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19173837 |
attctaagtttgaatattatttggagcaggtattgactttcacaaattggaaagtgtcatttat |
19173774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University