View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4813_high_12 (Length: 295)
Name: NF4813_high_12
Description: NF4813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4813_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 10 - 134
Target Start/End: Complemental strand, 3851357 - 3851236
Alignment:
| Q |
10 |
ataattctagtgaaggttttatgcctgattactctacttggatgaaacttgaagatgattacaatttgagatcctcaatggagccatcattaaatggaca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3851357 |
ataattctagtgaaggttttatgcctgattactctacttggatgaaacttgaagatgattacaatttgagatcctcaatggagc---cattaaatggaca |
3851261 |
T |
 |
| Q |
110 |
acttcaatatgattttttgagtttt |
134 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3851260 |
acttcaatatgattttttgagtttt |
3851236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 209 - 276
Target Start/End: Complemental strand, 3851161 - 3851094
Alignment:
| Q |
209 |
aagtagagaataggagatacaggatctggcacactgcagtaagggattctccacattcacgtcgtcgg |
276 |
Q |
| |
|
||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3851161 |
aagtagagaatagaagataagggatctggcacgctgcagtaagggattctccacattcacgtcgtcgg |
3851094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University