View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4813_high_22 (Length: 229)
Name: NF4813_high_22
Description: NF4813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4813_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 13407746 - 13407959
Alignment:
| Q |
1 |
tttttctacctctatgggaaactgagtttgtttggagttggaactcatcttaactttgagtattgcactttctctagtttttattctcgtcnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13407746 |
tttttctacctctatgggaaactgagtttgtttggagttggaactcatcttaactttgagtattgcactttctctagtttttattctcgtcatatatata |
13407845 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnngatgaacacacttcctcaatagttataacttataagtaaccatcagtatctatgagttgaaaaattctatgtttggatattatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13407846 |
tagatatagatatagatgaacacacttcctcaatagttataacttataagtaaccatcagtatctatgagttgaaaaattctatgtttggatattatttt |
13407945 |
T |
 |
| Q |
201 |
aagtcattgattct |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13407946 |
aagtcattgattct |
13407959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 19173992 - 19173905
Alignment:
| Q |
1 |
tttttctacctctatgggaaactgagtttgtttggagttggaactcatcttaactttgagtattgcactttctctagtttttattctcgt |
90 |
Q |
| |
|
|||||| |||||| |||||||||||| |||||||||||||||||||||||||||| ||||| ||| |||||||||||||| ||||||| |
|
|
| T |
19173992 |
tttttcaacctctgtgggaaactgagattgtttggagttggaactcatcttaactatgagttttg--ctttctctagttttggttctcgt |
19173905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University