View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4813_high_23 (Length: 222)
Name: NF4813_high_23
Description: NF4813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4813_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 15 - 171
Target Start/End: Original strand, 52188215 - 52188371
Alignment:
| Q |
15 |
atgaacttgagttgctacttgtgnnnnnnncttgattgtacatcttaaatcacatgttggaccagtaattttagtcattcacttcatagaagcttcgctg |
114 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
52188215 |
atgaacttgagttgctacttgtgaaaaaaacttgattgtacatcttaaatcacatgttggaccagtaattttagtcattcacttcataggagcttcactg |
52188314 |
T |
|
| Q |
115 |
atactaatttacaaaaaaaagtcgtgataagtttataagtattaagtagattccttc |
171 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52188315 |
atactaatttacaaaaaaaagtcgtaataagtttataagtattaagtagattccttc |
52188371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 38990475 - 38990538
Alignment:
| Q |
15 |
atgaacttgagttgctacttgtgnnnnnnncttgattgtacatcttaaatcacatgttggacca |
78 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||| ||||| ||||||||||| |
|
|
| T |
38990475 |
atgaacttgagttgctagttgtgaaaaaaacttgattgtacatcttgaatcatatgttggacca |
38990538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University