View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4813_high_6 (Length: 423)
Name: NF4813_high_6
Description: NF4813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4813_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 14 - 404
Target Start/End: Complemental strand, 18268829 - 18268439
Alignment:
| Q |
14 |
tacttcatcgtttttcacttcgattttgttccttttaggagtgttgttctgagaatcattatcatcaataacgatttcacgtttgagaattttcttcccc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18268829 |
tacttcatcgtttttcacttcgattttgttccttttaggagtgttgttctgagaatcattatcatcgataacgatttcacgtttgagaattttcttcccc |
18268730 |
T |
|
| Q |
114 |
gatcgcaagttcacaaaaccgttcggtatcggattaggttcggaatccgaagcggtaaggtttgatttatccattttctgtttcttcggttcggaaaccc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18268729 |
gatcgcaagttcacaaaaccgttcggtattggattaggttcggaatccgaagcggtaagatttgatttatccattttctgtttcttcggttcggaaaccc |
18268630 |
T |
|
| Q |
214 |
tagcggtggttggttcgggggtagttaaggctggttcggagttagcgagacggaggctgcgacggcgaggaggagcggaggaggaagaaatggaaggaga |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18268629 |
tagcggtggttggttcgggggtagttaaggctggttcggagttagcgagacggaggctgcgacggcgaggaggagcggaggaggaagaaagggaaggaga |
18268530 |
T |
|
| Q |
314 |
ttcggtggtttgagtgggagtgagggggtgtatgggtttagaggggggtgtagttttagttggtggagacattttcggcgatgaataagga |
404 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18268529 |
ttcggtggtttgagtaggagtgagggggtgtatgggtttagaggggggtgtagttttagttggtggagacattttcggctatgaataagga |
18268439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University