View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4813_low_19 (Length: 243)
Name: NF4813_low_19
Description: NF4813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4813_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 236
Target Start/End: Original strand, 31465508 - 31465736
Alignment:
| Q |
8 |
gacggtggtgatggtgatgattttttgatgaaatgagaatctttattgattttcaaatgtggtggtaacaatccattaacgttggtgttagattttgtgg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31465508 |
gacggtggtgatggtgatgattttttgatgaaatgagaatctttattgattttcaaatgtggtggtaacaatccattaacgttggtgttagattttgtgg |
31465607 |
T |
|
| Q |
108 |
tggttgagatgatttctttctttggatgaaattgtgaaggactcatgttttgatttttcaagaaaatgttaacaatcacacaaacaatatagataaatga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31465608 |
tggttgagatgatttctttctttggatgaaattgtgaaggactcatgttttgatttttcaagaaaatgttaacaatcacacaaacaatatagataaatga |
31465707 |
T |
|
| Q |
208 |
aatttaggtttatggttatgaagaattat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31465708 |
aatttaggtttatggttatgaagaattat |
31465736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University