View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4814_high_2 (Length: 340)
Name: NF4814_high_2
Description: NF4814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4814_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 8086226 - 8085987
Alignment:
| Q |
11 |
taatactcatggttttgctaaattgttaatcaccggcgattgttagagtggcgatcagtggtggttgatggtagccaactgagtggtagccaatggagat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8086226 |
taatactcatggttttgctaaattgttaatcaccggcgattgctagagtggcgatcagtggtggttggtggtagccaactgagtggtagccaatggagat |
8086127 |
T |
 |
| Q |
111 |
caaattaagtgggggtgagaggcggctagagttttggtcataata-taatcagtggtggttggaattgttgtcaatggtgatcaaagtgatggatgacga |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8086126 |
caaattaagtgggggtgagaggcggctagagttttggtcataatagtaatcagtggtggttggaattgttgtcaatggtgatcaaagtgatggatgacga |
8086027 |
T |
 |
| Q |
210 |
aggtgttcagataagtgattgttttcttcttgcattacactac |
252 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8086026 |
aggtgttcagataagtgattgtt---ttcttgcattacactac |
8085987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University