View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4814_low_2 (Length: 340)

Name: NF4814_low_2
Description: NF4814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4814_low_2
NF4814_low_2
[»] chr2 (1 HSPs)
chr2 (11-252)||(8085987-8086226)


Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 8086226 - 8085987
Alignment:
11 taatactcatggttttgctaaattgttaatcaccggcgattgttagagtggcgatcagtggtggttgatggtagccaactgagtggtagccaatggagat 110  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
8086226 taatactcatggttttgctaaattgttaatcaccggcgattgctagagtggcgatcagtggtggttggtggtagccaactgagtggtagccaatggagat 8086127  T
111 caaattaagtgggggtgagaggcggctagagttttggtcataata-taatcagtggtggttggaattgttgtcaatggtgatcaaagtgatggatgacga 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8086126 caaattaagtgggggtgagaggcggctagagttttggtcataatagtaatcagtggtggttggaattgttgtcaatggtgatcaaagtgatggatgacga 8086027  T
210 aggtgttcagataagtgattgttttcttcttgcattacactac 252  Q
    |||||||||||||||||||||||   |||||||||||||||||    
8086026 aggtgttcagataagtgattgtt---ttcttgcattacactac 8085987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University