View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4815-Insertion-20 (Length: 141)
Name: NF4815-Insertion-20
Description: NF4815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4815-Insertion-20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 7e-41; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 7e-41
Query Start/End: Original strand, 8 - 120
Target Start/End: Complemental strand, 34732508 - 34732395
Alignment:
| Q |
8 |
aagttttcatgagtgttttgtctattcctctatgctgtaattgtgttttgattcaaatgtgtttgtaca-nnnnnnnggcttattattttctgagataga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34732508 |
aagttttcatgagtgttttgtctattcctctatgctgtaattgtgttttgattcaaatgtgtttgtacattttttttggcttattattttctgagataga |
34732409 |
T |
 |
| Q |
107 |
tagcttttcttgag |
120 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34732408 |
tagcttttcttgag |
34732395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University