View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4815_high_2 (Length: 251)

Name: NF4815_high_2
Description: NF4815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4815_high_2
NF4815_high_2
[»] chr3 (1 HSPs)
chr3 (54-120)||(8140198-8140264)


Alignment Details
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 54 - 120
Target Start/End: Original strand, 8140198 - 8140264
Alignment:
54 agatttattaaataactaacgtatcaggattatattatagactaaacatatcatttatttaacgaat 120  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||    
8140198 agatttattaaataactaacgtatcaggattatattatagtctaaacatatcatttatttaatgaat 8140264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University