View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4815_high_3 (Length: 237)
Name: NF4815_high_3
Description: NF4815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4815_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 17 - 101
Target Start/End: Original strand, 8140370 - 8140454
Alignment:
| Q |
17 |
agatgatatttgaaatagtaatctcagccacattgcaataattgatattgtagacaattattctcaattatagttgatgtggtcc |
101 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
8140370 |
agatgatatttgaaatagtaatcttagccacattgcaataattgatattgtagacaatcattctcaattataattgatgtggtcc |
8140454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 148 - 222
Target Start/End: Original strand, 8140443 - 8140519
Alignment:
| Q |
148 |
ttgatgtggtccatgcacaaggatga--cacacaaattgagagaaataaattttatgtggtcctaattgcatgttat |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8140443 |
ttgatgtggtccatgcacaaggatgagacacacaaattgagagaaataaattttatgtggtcctaattgcatgttat |
8140519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University