View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4815_low_3 (Length: 237)

Name: NF4815_low_3
Description: NF4815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4815_low_3
NF4815_low_3
[»] chr3 (2 HSPs)
chr3 (17-101)||(8140370-8140454)
chr3 (148-222)||(8140443-8140519)


Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 17 - 101
Target Start/End: Original strand, 8140370 - 8140454
Alignment:
17 agatgatatttgaaatagtaatctcagccacattgcaataattgatattgtagacaattattctcaattatagttgatgtggtcc 101  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||    
8140370 agatgatatttgaaatagtaatcttagccacattgcaataattgatattgtagacaatcattctcaattataattgatgtggtcc 8140454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 148 - 222
Target Start/End: Original strand, 8140443 - 8140519
Alignment:
148 ttgatgtggtccatgcacaaggatga--cacacaaattgagagaaataaattttatgtggtcctaattgcatgttat 222  Q
    ||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||    
8140443 ttgatgtggtccatgcacaaggatgagacacacaaattgagagaaataaattttatgtggtcctaattgcatgttat 8140519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University