View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4817-Insertion-7 (Length: 135)
Name: NF4817-Insertion-7
Description: NF4817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4817-Insertion-7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 9 - 128
Target Start/End: Original strand, 122257 - 122376
Alignment:
| Q |
9 |
attttggggcgtagatttacgtggtatcacccaaatggaagtgctatgactcgcattcatagagttattctttcagaggagtgggttagaatttagggat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
122257 |
attttggggcgtagatttacgtggtatcacccaaatggaagtgctatgactcgcattcatagagttattctttcagaggagtgggttagaatttagggat |
122356 |
T |
 |
| Q |
109 |
ggggtctctttgggtgttgt |
128 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
122357 |
ggggtctctttgggtgttgt |
122376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University