View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4817_high_14 (Length: 319)
Name: NF4817_high_14
Description: NF4817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4817_high_14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] scaffold1371 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 90 - 319
Target Start/End: Original strand, 34899746 - 34899975
Alignment:
| Q |
90 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactgta |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34899746 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
34899845 |
T |
|
| Q |
190 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899846 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
34899945 |
T |
|
| Q |
290 |
gtttggtagtttcaactttcaagttgagat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34899946 |
gtttggtagtttcaactttcaagttgagat |
34899975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1371 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold1371
Description:
Target: scaffold1371; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 34
Target Start/End: Complemental strand, 1590 - 1558
Alignment:
| Q |
2 |
atgacaaaatcctgcaaaagctgaactgccact |
34 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1590 |
atgacaaaatcctgcaaaagctgaactgccact |
1558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 34
Target Start/End: Original strand, 9670725 - 9670757
Alignment:
| Q |
2 |
atgacaaaatcctgcaaaagctgaactgccact |
34 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9670725 |
atgacaaaatcctgcaaaagctgaactgccact |
9670757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University