View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4818-Insertion-11 (Length: 119)
Name: NF4818-Insertion-11
Description: NF4818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4818-Insertion-11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 7 - 119
Target Start/End: Complemental strand, 47201912 - 47201800
Alignment:
| Q |
7 |
acaaacaagtacagtgtgtgtgttacactaaattcaacagtaccatattcttattattagtattataagaagaaacaaagtagccaacttttttcacttg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201912 |
acaaacaagtacagtgtgtgtgttacactaaattcaatagtaccatattcttattattagtattataagaagaaacaaagtagccaacttttttcacttg |
47201813 |
T |
|
| Q |
107 |
tcgttcatggctt |
119 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47201812 |
tcgttcatggctt |
47201800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University