View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4818-Insertion-6 (Length: 346)
Name: NF4818-Insertion-6
Description: NF4818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4818-Insertion-6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 8 - 343
Target Start/End: Complemental strand, 5418422 - 5418087
Alignment:
| Q |
8 |
agttaaaccaaattcaaggttattgagtcaatttatgagtcttttagctttggtttgtgaaatgtattgacatctcaaaattgcaagcaaagagacagct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5418422 |
agttaaaccaaattcaaggttattgagtcaatttatgagtcttttagctttgttttgtgaaatgtattgacatctcaaaattgcaagcaaagagacagct |
5418323 |
T |
|
| Q |
108 |
ggatagtgggtttggtagtgtggtattatgtgcggaagccgcgtacgtactttatggctttattgatccatactcgaatttaattgtcgtttgtccccta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5418322 |
ggatagtgggtttggtagtgtggtattatgtgcggaagccgcgtacgtactttatggctttattgatccatactcgaatttaattgtcgtttgtccccta |
5418223 |
T |
|
| Q |
208 |
tatgtatatatattgattgatcatcaagatgaaacgttgcatatgcatattgatattgtcaaattgccatattcattgcattgtatgaattgttcatagc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5418222 |
tatgtatatatattgattgatcatcaagatgaaacgttgcatatgcatattgatattgtcaaattgccatattcattgcattgtatgagttgttcatagc |
5418123 |
T |
|
| Q |
308 |
accaaaaactgtgtttgtttacgtggcttttttctc |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
5418122 |
accaaaaactgtgtttgtttacgtggcttttttctc |
5418087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University