View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4821-Insertion-13 (Length: 73)
Name: NF4821-Insertion-13
Description: NF4821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4821-Insertion-13 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 4e-25; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 8 - 73
Target Start/End: Original strand, 43797305 - 43797370
Alignment:
| Q |
8 |
atatgtttcattgattccttatgagtttagtctttgtgactttcgtttttcttgtcccacttttta |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
43797305 |
atatgtttcattgattccttatgagtttagtctttgtaactttcgtttttcttgtccaacttttta |
43797370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 44
Target Start/End: Original strand, 43798412 - 43798447
Alignment:
| Q |
10 |
atgtttcattgatt-ccttatgagtttagtctttgt |
44 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43798412 |
atgtttcattgatttccttatgagtttagtctttgt |
43798447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University