View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4821_high_3 (Length: 330)
Name: NF4821_high_3
Description: NF4821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4821_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 8 - 322
Target Start/End: Complemental strand, 45059757 - 45059443
Alignment:
| Q |
8 |
gattattctcaaaagtccttctaccaatatcaaaatttgacacaacagaacatgtttcagcattcatatcagtagttagatcagtttcctgtgacacact |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45059757 |
gattattctcaaaagtccttctaccaatatccaaatttgacacaacagaacatgtttcagcattcatatcagtagttagatcagtttcctgtgacacact |
45059658 |
T |
|
| Q |
108 |
cataatttgttgctgtctctcagtcttgaaaccattgttttcatacaaagctcttaaaattgcttgatcttgcataccacaaacagaacttggatattgc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45059657 |
cataatttgttgctgtctctcagtcttgaaaccattgttttcatacaaagctcttaaaattgcttgatcttgcataccacaaacagaacttggatattgc |
45059558 |
T |
|
| Q |
208 |
aaattaaccgcagcttgattattagagtataatgaaccattagaagatgagattcttgggaaaaaatatagttgattatgtgaagaaacaccataaattg |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
45059557 |
aaattaaccgcagcttgattattagagtataatgaaccattagaagatgagattcttgggaaaaaatctagttgattatgtgaagaaataccataaattg |
45059458 |
T |
|
| Q |
308 |
agttgttgtatgaat |
322 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
45059457 |
agttgttgaatgaat |
45059443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 35363283 - 35363242
Alignment:
| Q |
111 |
aatttgttgctgtctctcagtcttgaaaccattgttttcata |
152 |
Q |
| |
|
||||||||| | ||||||||| |||||||||||||||||||| |
|
|
| T |
35363283 |
aatttgttgttatctctcagttttgaaaccattgttttcata |
35363242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University