View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4821_low_14 (Length: 239)
Name: NF4821_low_14
Description: NF4821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4821_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 5 - 221
Target Start/End: Original strand, 55642029 - 55642238
Alignment:
| Q |
5 |
gcaacaacagggagaaactacaaaatgtttgataattaatgccttaagaatcataaatattcctacaatatcagttgatcttaatatcaaaatgcagatg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55642029 |
gcaacaacagggagaaactacaaaatgtttgataat----gccttaagaatcataaatattcctacaatatcagttgatcttaatatcaaaatgcagatg |
55642124 |
T |
|
| Q |
105 |
tttctgaaactataatacaatatcaacataatcagaaaagatggtttttgctgttaccccaaaaaggtgcaccccataatacaaagcttgaatagatagt |
204 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55642125 |
tttctgaaactataataca---tctacataatcagaaaagatggtttttgctattaacccaaaaaggtgcaccccataatacaaagcttgaatagatagt |
55642221 |
T |
|
| Q |
205 |
taatgaagccagcaaaa |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
55642222 |
taatgaagccagcaaaa |
55642238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University