View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4821_low_4 (Length: 328)
Name: NF4821_low_4
Description: NF4821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4821_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 194 - 310
Target Start/End: Complemental strand, 45059173 - 45059057
Alignment:
| Q |
194 |
ggttaagtacaataagaaaaacagataagaaagtttatagaagaatacctttgcagcttttggaagattgtgaacagagaatttaccctcaagtcgatat |
293 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45059173 |
ggttaagtacaataagaaaaacagagaagaaagtttatagaagaatacctttgcagcttttggaagattgtgaacagagaatttaccctcaagtcgatat |
45059074 |
T |
 |
| Q |
294 |
tcatgcatgacccaatt |
310 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45059073 |
tcatgcatgacccaatt |
45059057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 45059366 - 45059238
Alignment:
| Q |
1 |
tttgattttcccaattgaattcgacgtatcagtaagtggtggtaaaacagaacaaccaaattcattaccaagtgaatccaacctcattataccagaaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45059366 |
tttgattttcccaattgaattcgacgaatcagtaagtggtggtaaaacagaacaaccaaattcattaccaagtgaatccaacctcattataccagaaata |
45059267 |
T |
 |
| Q |
101 |
tgtgnnnnnnncccagctgaactcttctg |
129 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
45059266 |
tgtgtttttttcccagctgaactcttctg |
45059238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 239 - 310
Target Start/End: Original strand, 11462856 - 11462927
Alignment:
| Q |
239 |
tacctttgcagcttttggaagattgtgaacagagaatttaccctcaagtcgatattcatgcatgacccaatt |
310 |
Q |
| |
|
|||||| |||| ||| || || |||| ||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
11462856 |
taccttggcagttttagggaggttgtaaacagagaatttaccctcaagtctatattcatgcattacccaatt |
11462927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University