View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4822_low_4 (Length: 260)
Name: NF4822_low_4
Description: NF4822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4822_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 249
Target Start/End: Original strand, 6684580 - 6684814
Alignment:
| Q |
19 |
gaactcgcaagggttgtcttatctctcacaagtaataataaataa----ataaaatgaaaactcctaatatgtgatgttagagataaggatagtaggata |
114 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6684580 |
gaactcacaagggttgtctaatctctcacaagtaataataaataagtatataaaatgaaaactcctaatatgtgatgttagagataaggatagtaggata |
6684679 |
T |
|
| Q |
115 |
cttctgcgatggggattggctgatttagtttatgttgtagaaactgcaaagacaaacgtaaagaaatgtccttttctttttccctttttattgtttattt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6684680 |
cttctgcgatggggattggctgatttagtttatgttgtggaaactgcaaagacaaacgtaaagaaatgtcctttcctttttccctttttattgtttattt |
6684779 |
T |
|
| Q |
215 |
ggtttatatattctatcaaaaagaccacgagtatt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6684780 |
ggtttatatattctatcaaaaagaccacgagtatt |
6684814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University