View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4822_low_6 (Length: 245)

Name: NF4822_low_6
Description: NF4822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4822_low_6
NF4822_low_6
[»] chr1 (1 HSPs)
chr1 (96-236)||(43047283-43047422)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 96 - 236
Target Start/End: Original strand, 43047283 - 43047422
Alignment:
96 gtatgagtatagaaaaccatcgactccttgaaaactatcgatgattggtaaataaaagaactattggattcagaattgcgattaagcatgtacatggatg 195  Q
    ||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
43047283 gtatgagtatagaaaaccatcaactccttgaaaacta-cgatgattagtaaataaaagaactattggattcagaattgcgattaagcatgtacatggatg 43047381  T
196 gaatggaaaaacaagaaatcgaaaaacaaaagcagtataat 236  Q
    |||||||||||||||||||||||||||||||||| ||||||    
43047382 gaatggaaaaacaagaaatcgaaaaacaaaagcattataat 43047422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University