View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4823-Insertion-8 (Length: 146)
Name: NF4823-Insertion-8
Description: NF4823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4823-Insertion-8 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 8 - 146
Target Start/End: Complemental strand, 44838864 - 44838723
Alignment:
| Q |
8 |
catccatcagcattacgtattccttataaatttcattttattataagttttccaccttga---gtaagtacttgtactctccttcatatttttctagata |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44838864 |
catccatcagcattacgtattccttataaatttcattttattataagttttccaccttgatcagtaagtacttgtactctccttcatatttttctagata |
44838765 |
T |
|
| Q |
105 |
acacattgtcttctacttgcattaaaatcactgaaacctttc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44838764 |
acacattgtcttctacttgcattaaaatcactgaaacctttc |
44838723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University