View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4825-Insertion-6 (Length: 213)
Name: NF4825-Insertion-6
Description: NF4825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4825-Insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 8 - 187
Target Start/End: Original strand, 54060790 - 54060969
Alignment:
| Q |
8 |
caaaagtgcattgtacttgttcttcttcaactactgtgttttgcatcagctttcatgtgataatagaggtccttttgcagcaacattgtggagcttgtgg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54060790 |
caaaagtgcattgtacttgttcttcttcaactactgtgttttgcatcagctttcatgtgataatagaggtccttttgcagcaacattgtggagcttgtgg |
54060889 |
T |
|
| Q |
108 |
aagagtacaaagtacaaacattgcggtttgggagaataaagttgaacggccagctgagtttatttataggggattatttt |
187 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54060890 |
aagagtacaaagtacaaacattgcagtttgggagaataaagttgaacggccagctgagtttatttataggggattatttt |
54060969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University