View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4825_high_12 (Length: 234)
Name: NF4825_high_12
Description: NF4825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4825_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 217
Target Start/End: Complemental strand, 44017198 - 44016993
Alignment:
| Q |
12 |
tcaccttcaccttcaccctcatcttctacattaatctccgactccaagtaaagccaccattttcacaatcaaaaatggaaaatattagtgttacctcttt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44017198 |
tcaccttcaccttcaccctcatcttctacattaatctccaactccaagtaaagtcaccattttcacaatcaaaaatggaaaatattagtgttacctcttt |
44017099 |
T |
 |
| Q |
112 |
gttcttttgcttactcttttttagcataacaaagatacaagtaataacttctctttcacctgatggacaagcacttctttctcttgcaacatcatcacct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44017098 |
gttcttttgcttactcttttttagcataacaaagatacaagtaataacttctctttcacctgatggacaagcacttctttctcttgcaacatcatcacct |
44016999 |
T |
 |
| Q |
212 |
tctatt |
217 |
Q |
| |
|
|||||| |
|
|
| T |
44016998 |
tctatt |
44016993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University