View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4825_high_13 (Length: 230)

Name: NF4825_high_13
Description: NF4825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4825_high_13
NF4825_high_13
[»] chr3 (2 HSPs)
chr3 (144-211)||(3851094-3851161)
chr3 (32-69)||(3851236-3851273)


Alignment Details
Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 144 - 211
Target Start/End: Complemental strand, 3851161 - 3851094
Alignment:
144 aagtagagaataggagatacaggatctggcacactgcagtaagggattctccacattcacgtcgtcgg 211  Q
    ||||||||||||| |||||  ||||||||||| |||||||||||||||||||||||||||||||||||    
3851161 aagtagagaatagaagataagggatctggcacgctgcagtaagggattctccacattcacgtcgtcgg 3851094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 32 - 69
Target Start/End: Complemental strand, 3851273 - 3851236
Alignment:
32 cattaaatggacaacttcaatatgattttttgagtttt 69  Q
    ||||||||||||||||||||||||||||||||||||||    
3851273 cattaaatggacaacttcaatatgattttttgagtttt 3851236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University