View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4825_high_9 (Length: 242)
Name: NF4825_high_9
Description: NF4825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4825_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 24598962 - 24598728
Alignment:
| Q |
1 |
atgatgagtttattactttattcaagacaagatatttatagttgaaaagatgttagaattagttaatcaaaccgaataaatagatgaagtatataaaggc |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24598962 |
atgatgagtttattattttattcaagacaagatatttatagttgaaaagatcttagaattagttaatcaaaccgaataaatagatgaagtatataaaggc |
24598863 |
T |
 |
| Q |
101 |
atgaaagggttgctagacaatgtgcataa---tcatattaa-gccaagtcaagtctttgtccacaaccataagaaaccg----taatagcagctgctaga |
192 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24598862 |
atgaaagggtagctagacaatgtgcataatcatcatattaaggcaaagtcaagtctttgtccacaaccataagaaaccgtaattaatagcagctgctaga |
24598763 |
T |
 |
| Q |
193 |
gaatgcattgtttctgttgatgtcgatagaggtga |
227 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
24598762 |
gaatgcatcgtttctgttgatgtcgatagaggtga |
24598728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University