View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4825_low_14 (Length: 230)
Name: NF4825_low_14
Description: NF4825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4825_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 144 - 211
Target Start/End: Complemental strand, 3851161 - 3851094
Alignment:
| Q |
144 |
aagtagagaataggagatacaggatctggcacactgcagtaagggattctccacattcacgtcgtcgg |
211 |
Q |
| |
|
||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3851161 |
aagtagagaatagaagataagggatctggcacgctgcagtaagggattctccacattcacgtcgtcgg |
3851094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 32 - 69
Target Start/End: Complemental strand, 3851273 - 3851236
Alignment:
| Q |
32 |
cattaaatggacaacttcaatatgattttttgagtttt |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3851273 |
cattaaatggacaacttcaatatgattttttgagtttt |
3851236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University