View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4825_low_16 (Length: 228)
Name: NF4825_low_16
Description: NF4825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4825_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 73 - 212
Target Start/End: Complemental strand, 7380797 - 7380658
Alignment:
| Q |
73 |
aagctgttttggctaacatgattaggtaaagttctaggtatttgaattttgatgttgggaaccatgttggtgaaatgtacgaatttggatttttaatatg |
172 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7380797 |
aagctgttgtggctaacatgattaggtaaagttctaggtatttgaattttgatgttgggaaccatgttggtgaaatgtatgaatttggatttttaatatg |
7380698 |
T |
|
| Q |
173 |
gagtttgatgtggttgaaaaggtgccatagccctagtatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7380697 |
gagtttgatgtggttgaaaaggtgccatagccctagtatt |
7380658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 82
Target Start/End: Original strand, 7383259 - 7383296
Alignment:
| Q |
45 |
gcttagtataccatagatcaatttagataagctgtttt |
82 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7383259 |
gcttagtatacaatagatcaatttagataagctgtttt |
7383296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University