View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4825_low_17 (Length: 227)
Name: NF4825_low_17
Description: NF4825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4825_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 5320815 - 5321009
Alignment:
| Q |
1 |
cgatccttttgataaattcatactcatattcatatctgtcaaagtacaaaatgttacgaatactcagactaaactctacaaggctagcttgttataatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5320815 |
cgatccttttgataaattcatactcatattcatatctgtcaaagtacaaaatgttacgaatactcagactaaactctacaaggctaacttgttataatta |
5320914 |
T |
|
| Q |
101 |
attgacttctaacagaaagtgaactaccaaacttcttacagaaaaattaactagcacaactaacttttaagctagaactacaatatcaaatattg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5320915 |
attgacttctaacagaaagtgaactaccaaacttcttacagaaaaattaactaccacaactaacttttaagctagaactacaatatcaaatattg |
5321009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University