View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4825_low_9 (Length: 253)
Name: NF4825_low_9
Description: NF4825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4825_low_9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 253
Target Start/End: Original strand, 15380539 - 15380782
Alignment:
| Q |
11 |
aatgagagacatgtagagagtgagaaagggaaataatata-ctccacaaagatgcaattaatggattggtcatgtaactggtaagtgtgaatgaaagaag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15380539 |
aatgagagacatgtagagagtgagaaagggaaataatataactccacaaagatgcaattaatggattggtcatgtaactggtaagtgtggatgaaagaag |
15380638 |
T |
 |
| Q |
110 |
tgggaattctgaactcaaaatgtgttttggttatttgttgaaaggggagaacattgtgggacattgcttgaaagctttgaaagaaaagcagagtctcaca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15380639 |
tgggaattctgaactcaaaatgtgttttggttatttgttgaaaggggagaacattgtgggacattgcttgaaagctttgaaagaaaagcagagtctcaca |
15380738 |
T |
 |
| Q |
210 |
gagcagttatatcaattggtttgaaactttggaatctgaactat |
253 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
15380739 |
gagcagttatatcaattgggttgaaactttggaatttgaactat |
15380782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University