View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4827-Insertion-10 (Length: 174)
Name: NF4827-Insertion-10
Description: NF4827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4827-Insertion-10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 7 - 174
Target Start/End: Original strand, 35167833 - 35168000
Alignment:
| Q |
7 |
acttggttagttacaggtagaacaatgcaactgcttcatatgcgtagttcaatattannnnnnnnatcagtaggaatcatattcagtaccctgaggttta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35167833 |
acttggttagttacaggtagaacaatgcaactgcttcatatgcgtagttcaatattattttttttatcagtaggaatcatattcagtaccctgaggttta |
35167932 |
T |
|
| Q |
107 |
taacactaacatacattgcagaccaagcacttgcgctagacttcggttgtaagtcataagctattata |
174 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35167933 |
taacactaacatacattgcggaccaagcacttgcgctagacttcggttgtaagtcataagctattata |
35168000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University