View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4828_high_5 (Length: 325)
Name: NF4828_high_5
Description: NF4828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4828_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 46332638 - 46332928
Alignment:
| Q |
1 |
agatggttttaatgatgatgatttcaaattgagtaatatctttggttaaatatgatacgcactttgcattaattttaattattatt---ttctgtggttg |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46332638 |
agatggttttaatgatgatgatttcaaattgagtaatatctttggttaaatatgatacacactttgcattaattttaattattattatcttctgtggttg |
46332737 |
T |
 |
| Q |
98 |
aaatagcttgaaaggtctgcttcatacagcctacaacggcgacccagaagaccacctcctgacttgccatcaattctgcttaacggtcgaattatttaca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
46332738 |
aaatagcttgaaaggtctgcttcatacagccaacaacgacgacccaaaagaccacctcctgacttgccatcacttctgcttaacggtcgaattgtttaca |
46332837 |
T |
 |
| Q |
198 |
ttggcatgcctgtaagtgttcaattctgcattga-tttatgttttcttgtatattggtacaaattatgatctatgaagcttagacactgac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46332838 |
ttggcatgcctgtaagtgttcaattctgcattgattttatgttttcttgtatattggtacaaattatgatctatgaagcttagacactgac |
46332928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University