View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4829-Insertion-10 (Length: 49)
Name: NF4829-Insertion-10
Description: NF4829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4829-Insertion-10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 37; Significance: 0.0000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.0000000000008
Query Start/End: Original strand, 8 - 44
Target Start/End: Original strand, 27897771 - 27897807
Alignment:
| Q |
8 |
tatactactataacccctttattaatatggttttctt |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27897771 |
tatactactataacccctttattaatatggttttctt |
27897807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University