View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4829-Insertion-11 (Length: 39)
Name: NF4829-Insertion-11
Description: NF4829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4829-Insertion-11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 32; Significance: 0.0000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.0000000005
Query Start/End: Original strand, 8 - 39
Target Start/End: Original strand, 38867758 - 38867789
Alignment:
| Q |
8 |
cattcaacccctttcaatctagaaatatggag |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38867758 |
cattcaacccctttcaatctagaaatatggag |
38867789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 28; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 28; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 39
Target Start/End: Complemental strand, 39953785 - 39953754
Alignment:
| Q |
8 |
cattcaacccctttcaatctagaaatatggag |
39 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
39953785 |
cattcaacccctttcaatctagcaatatggag |
39953754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University